Transcript: Mouse XM_006529236.3

PREDICTED: Mus musculus neutrophil cytosolic factor 2 (Ncf2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncf2 (17970)
Length:
2394
CDS:
676..2253

Additional Resources:

NCBI RefSeq record:
XM_006529236.3
NBCI Gene record:
Ncf2 (17970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255505 ACTTACCATTTCCCTATTAAA pLKO_005 2353 3UTR 100% 15.000 21.000 N Ncf2 n/a
2 TRCN0000255504 GTGGGTGACCAAGGTCTTATT pLKO_005 1960 CDS 100% 13.200 18.480 N Ncf2 n/a
3 TRCN0000070660 GCTTCGGAACATGGTGTCTAA pLKO.1 1794 CDS 100% 4.950 6.930 N Ncf2 n/a
4 TRCN0000255503 TACCTCTCCAGAATCCGATAT pLKO_005 1605 CDS 100% 0.000 0.000 N Ncf2 n/a
5 TRCN0000070659 CCTTGCTATCAAAGACCTTAA pLKO.1 939 CDS 100% 10.800 7.560 N Ncf2 n/a
6 TRCN0000255506 TGCCTGGGAACATCGTCTTTG pLKO_005 1460 CDS 100% 10.800 7.560 N Ncf2 n/a
7 TRCN0000070661 GCCAAGAATTTGGAAGGCATT pLKO.1 2218 CDS 100% 4.050 2.835 N Ncf2 n/a
8 TRCN0000070662 GCCTATGCCTTACATGCTCAA pLKO.1 1716 CDS 100% 4.050 2.835 N Ncf2 n/a
9 TRCN0000038932 GCTATCAAAGACCTTAAAGAA pLKO.1 943 CDS 100% 5.625 4.500 N NCF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.