Transcript: Mouse XM_006529259.3

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, C (Ptprc), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptprc (19264)
Length:
5098
CDS:
118..3999

Additional Resources:

NCBI RefSeq record:
XM_006529259.3
NBCI Gene record:
Ptprc (19264)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340019 GAAAGCTTGAAACCTTATAAA pLKO_005 1423 CDS 100% 15.000 21.000 N Ptprc n/a
2 TRCN0000339951 CAAACTTCGACGGAGAGTTAA pLKO_005 2580 CDS 100% 13.200 18.480 N Ptprc n/a
3 TRCN0000220415 CGGGCTTTCAAAGATATTGTT pLKO.1 2404 CDS 100% 5.625 7.875 N Ptprc n/a
4 TRCN0000220419 GCACAGTATATCCTGATTCAT pLKO.1 2782 CDS 100% 5.625 7.875 N Ptprc n/a
5 TRCN0000339950 ATGCAGGGTCCACCTACATAA pLKO_005 2189 CDS 100% 13.200 10.560 N Ptprc n/a
6 TRCN0000220418 GCCTAATAATGTGACCAGTTT pLKO.1 1395 CDS 100% 4.950 3.960 N Ptprc n/a
7 TRCN0000340020 TCACCTTTGCCACTGTATAAA pLKO_005 4103 3UTR 100% 15.000 10.500 N Ptprc n/a
8 TRCN0000340021 TACACCTATGAATCTAGTAAT pLKO_005 757 CDS 100% 13.200 9.240 N Ptprc n/a
9 TRCN0000220417 CCTTGTTCAATCTCTTGGAAA pLKO.1 3623 CDS 100% 4.950 3.465 N Ptprc n/a
10 TRCN0000220416 GCTGCCATGTTTGGGAACATT pLKO.1 727 CDS 100% 0.563 0.394 N Ptprc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.