Transcript: Mouse XM_006529317.2

PREDICTED: Mus musculus sushi, nidogen and EGF-like domains 1 (Sned1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sned1 (208777)
Length:
8997
CDS:
173..4210

Additional Resources:

NCBI RefSeq record:
XM_006529317.2
NBCI Gene record:
Sned1 (208777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099760 CCTCATTTATACTGACCTAAA pLKO.1 6312 3UTR 100% 10.800 15.120 N Sned1 n/a
2 TRCN0000099763 GCCCTTATAGATTCACTGGGA pLKO.1 1989 CDS 100% 0.660 0.924 N Sned1 n/a
3 TRCN0000099761 CCGGACTCTACGTGAACAATA pLKO.1 375 CDS 100% 13.200 9.240 N Sned1 n/a
4 TRCN0000056124 CCACTACATTGGCAAATACAA pLKO.1 2077 CDS 100% 5.625 3.938 N SNED1 n/a
5 TRCN0000099762 GCAGTAACTGTGAGATCACAA pLKO.1 3797 CDS 100% 4.950 3.465 N Sned1 n/a
6 TRCN0000099764 GTTAACACATTCCAAACTGTA pLKO.1 674 CDS 100% 4.950 3.465 N Sned1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8304 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 8308 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.