Transcript: Mouse XM_006529467.1

PREDICTED: Mus musculus GRB10 interacting GYF protein 2 (Gigyf2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gigyf2 (227331)
Length:
5725
CDS:
220..4074

Additional Resources:

NCBI RefSeq record:
XM_006529467.1
NBCI Gene record:
Gigyf2 (227331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277092 GACTATACCAGGGCCTATTTA pLKO_005 3730 CDS 100% 15.000 21.000 N Gigyf2 n/a
2 TRCN0000277089 TGCCCTTAATACGGCAAATAA pLKO_005 3648 CDS 100% 15.000 21.000 N Gigyf2 n/a
3 TRCN0000191028 CGACGAAAGATTGACATCAAA pLKO.1 1725 CDS 100% 5.625 4.500 N Gigyf2 n/a
4 TRCN0000414322 AGCAATGCAGAAGTGGTATTA pLKO_005 1794 CDS 100% 13.200 9.240 N GIGYF2 n/a
5 TRCN0000277093 ATACCGGCAAAGGGCCTTAAC pLKO_005 4473 3UTR 100% 10.800 7.560 N Gigyf2 n/a
6 TRCN0000200960 CCCTTTGATCTTCTGGAGAAA pLKO.1 394 CDS 100% 4.950 3.465 N Gigyf2 n/a
7 TRCN0000277090 CCCTTTGATCTTCTGGAGAAA pLKO_005 394 CDS 100% 4.950 3.465 N Gigyf2 n/a
8 TRCN0000189700 GCACACATTCCAACCTGCATA pLKO.1 3311 CDS 100% 4.950 3.465 N Gigyf2 n/a
9 TRCN0000191394 CGAGAAGAAATGTTAGCACTT pLKO.1 352 CDS 100% 4.050 2.835 N Gigyf2 n/a
10 TRCN0000277091 CGAGAAGAAATGTTAGCACTT pLKO_005 352 CDS 100% 4.050 2.835 N Gigyf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.