Transcript: Mouse XM_006529559.4

PREDICTED: Mus musculus RIKEN cDNA 4933406M09 gene (4933406M09Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mgat4f (240755)
Length:
2184
CDS:
174..1613

Additional Resources:

NCBI RefSeq record:
XM_006529559.4
NBCI Gene record:
Mgat4f (240755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529559.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430850 TATCGCAGCAGCACATGTAAA pLKO_005 272 CDS 100% 13.200 18.480 N Mgat4f n/a
2 TRCN0000093641 GTTGCCAACATTTCAGGTCTT pLKO.1 633 CDS 100% 4.050 3.240 N Mgat4f n/a
3 TRCN0000438292 GAACAGGACCTGGAGTATATG pLKO_005 561 CDS 100% 13.200 9.240 N Mgat4f n/a
4 TRCN0000093642 GTGATGGAGATTAGTTGTATA pLKO.1 1494 CDS 100% 13.200 9.240 N Mgat4f n/a
5 TRCN0000423655 TCTTGCCCTTCTCATGAATTT pLKO_005 776 CDS 100% 13.200 9.240 N Mgat4f n/a
6 TRCN0000093639 CCTCAACCTCTCTGAATACTT pLKO.1 800 CDS 100% 5.625 3.938 N Mgat4f n/a
7 TRCN0000093643 ACCATTGGTGAGAGGTCAGTT pLKO.1 1442 CDS 100% 4.950 3.465 N Mgat4f n/a
8 TRCN0000093640 CTCTACTAAGAATAGGTTGAA pLKO.1 1340 CDS 100% 4.950 3.465 N Mgat4f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529559.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.