Transcript: Mouse XM_006529683.3

PREDICTED: Mus musculus secretin receptor (Sctr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sctr (319229)
Length:
1810
CDS:
159..1553

Additional Resources:

NCBI RefSeq record:
XM_006529683.3
NBCI Gene record:
Sctr (319229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529683.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123920 CCTTCGTACACGGTTCATCAA pLKO.1 372 CDS 100% 4.950 6.930 N Sctr n/a
2 TRCN0000123921 AGACACTTTCTGGAGGACTTT pLKO.1 1029 CDS 100% 4.950 3.465 N Sctr n/a
3 TRCN0000123919 GAGGAAATGAAACACACCATT pLKO.1 1189 CDS 100% 4.950 3.465 N Sctr n/a
4 TRCN0000123923 GCGGGAACTCTCCGAAGAGAA pLKO.1 299 CDS 100% 1.650 1.155 N Sctr n/a
5 TRCN0000123922 GTCAACATGAATGGCTCCTTT pLKO.1 573 CDS 100% 4.950 2.970 N Sctr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529683.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.