Transcript: Mouse XM_006529771.3

PREDICTED: Mus musculus predicted gene 6086 (Gm6086), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gal3st2c (619597)
Length:
3378
CDS:
179..1369

Additional Resources:

NCBI RefSeq record:
XM_006529771.3
NBCI Gene record:
Gal3st2c (619597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529771.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270709 TCAGCATGAAGGAGATTTATT pLKO_005 2632 3UTR 100% 15.000 10.500 N Gal3st2c n/a
2 TRCN0000270615 TAGTTGGACCTTGGTAGTTAG pLKO_005 2891 3UTR 100% 10.800 7.560 N Gal3st2c n/a
3 TRCN0000270618 GATGCTGGCTCAGACCTTTAA pLKO_005 2350 3UTR 100% 13.200 7.920 N Gal3st2c n/a
4 TRCN0000270711 ACAAGGACTATGTTCGCAAAT pLKO_005 792 CDS 100% 10.800 6.480 N Gal3st2c n/a
5 TRCN0000270672 GTGTTAGGATGAGGTGTTTAA pLKO_005 2803 3UTR 100% 13.200 6.600 Y Gal3st2c n/a
6 TRCN0000099117 CAGCATTTCAATCGCACGTTT pLKO.1 1025 CDS 100% 4.950 2.475 Y Gal3st2 n/a
7 TRCN0000099118 CCCAAGAACCTGACACACATA pLKO.1 1154 CDS 100% 4.950 2.475 Y Gal3st2 n/a
8 TRCN0000099116 CGATTCCATCTGGTGCTCATT pLKO.1 833 CDS 100% 4.950 2.475 Y Gal3st2 n/a
9 TRCN0000099115 CCAGCATTTCAATCGCACGTT pLKO.1 1024 CDS 100% 2.640 1.320 Y Gal3st2 n/a
10 TRCN0000099119 CAGACTACTTCGATGAGTCTA pLKO.1 855 CDS 100% 0.495 0.248 Y Gal3st2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529771.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.