Transcript: Mouse XM_006530056.1

PREDICTED: Mus musculus protein kinase inhibitor, alpha (Pkia), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkia (18767)
Length:
3637
CDS:
5..361

Additional Resources:

NCBI RefSeq record:
XM_006530056.1
NBCI Gene record:
Pkia (18767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002808 CAAGTGGCAACAGCAATGAAT pLKO.1 222 CDS 100% 5.625 7.875 N PKIA n/a
2 TRCN0000012465 GCAATACATGATATCCTGGTT pLKO.1 194 CDS 100% 2.640 3.696 N Pkia n/a
3 TRCN0000321060 AGTGGCAACAGCAATGAATTA pLKO_005 224 CDS 100% 13.200 9.240 N Pkia n/a
4 TRCN0000012464 CAGCAATGAATTAGCCTTAAA pLKO.1 232 CDS 100% 13.200 9.240 N Pkia n/a
5 TRCN0000415787 AGAAATGCAATACATGATATC pLKO_005 188 CDS 100% 10.800 7.560 N PKIA n/a
6 TRCN0000321061 AGAAGCAGCCAAGTCTGAAAG pLKO_005 337 CDS 100% 10.800 7.560 N Pkia n/a
7 TRCN0000321059 AGAGAAGCTCCACCGAACAAA pLKO_005 300 CDS 100% 5.625 3.938 N Pkia n/a
8 TRCN0000002806 GCAAGTGGCAACAGCAATGAA pLKO.1 221 CDS 100% 5.625 3.938 N PKIA n/a
9 TRCN0000012463 GCCCTTTCATACCCAAATGTT pLKO.1 1425 3UTR 100% 5.625 3.938 N Pkia n/a
10 TRCN0000321058 GCCCTTTCATACCCAAATGTT pLKO_005 1425 3UTR 100% 5.625 3.938 N Pkia n/a
11 TRCN0000012467 GAACAGGTAGAAGAAATGCAA pLKO.1 177 CDS 100% 3.000 2.100 N Pkia n/a
12 TRCN0000320986 GAACAGGTAGAAGAAATGCAA pLKO_005 177 CDS 100% 3.000 2.100 N Pkia n/a
13 TRCN0000012466 TCCACCGAACAAAGTGGAGAA pLKO.1 308 CDS 100% 0.405 0.284 N Pkia n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.