Transcript: Mouse XM_006530139.3

PREDICTED: Mus musculus citron (Cit), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cit (12704)
Length:
8661
CDS:
158..6403

Additional Resources:

NCBI RefSeq record:
XM_006530139.3
NBCI Gene record:
Cit (12704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022749 GCCCGAGCATATCTGGAAATT pLKO.1 5897 CDS 100% 13.200 18.480 N Cit n/a
2 TRCN0000321836 TCGTCATCCTCCGCTACAATG pLKO_005 5442 CDS 100% 10.800 15.120 N Cit n/a
3 TRCN0000022751 GCCGCTAAGATGAATTCAAAT pLKO.1 884 CDS 100% 0.000 0.000 N Cit n/a
4 TRCN0000321774 GCCGCTAAGATGAATTCAAAT pLKO_005 884 CDS 100% 0.000 0.000 N Cit n/a
5 TRCN0000419892 CTCATACCAGGACAAGTTAAG pLKO_005 5974 CDS 100% 10.800 8.640 N Cit n/a
6 TRCN0000321837 CAACATCCCTCACCGGTTTAA pLKO_005 4345 CDS 100% 13.200 9.240 N Cit n/a
7 TRCN0000424293 TGCTGTGCTTCCACGAATTTG pLKO_005 5715 CDS 100% 13.200 9.240 N Cit n/a
8 TRCN0000022753 CCAGAAGTATTCCGACACCAT pLKO.1 388 CDS 100% 2.640 1.848 N Cit n/a
9 TRCN0000321835 CCAGAAGTATTCCGACACCAT pLKO_005 388 CDS 100% 2.640 1.848 N Cit n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530139.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.