Transcript: Mouse XM_006530189.3

PREDICTED: Mus musculus nitric oxide synthase 1, neuronal (Nos1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nos1 (18125)
Length:
9929
CDS:
508..4902

Additional Resources:

NCBI RefSeq record:
XM_006530189.3
NBCI Gene record:
Nos1 (18125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340861 ACAATCCAAGATAGATCATAT pLKO_005 4461 CDS 100% 13.200 18.480 N Nos1 n/a
2 TRCN0000072123 CCAAAGAATTTCTCGACCAAT pLKO.1 1580 CDS 100% 4.950 6.930 N Nos1 n/a
3 TRCN0000072125 CGTTCGTGATTACTGTGACAA pLKO.1 2289 CDS 100% 4.950 6.930 N Nos1 n/a
4 TRCN0000072124 GCCATCACTATATTCCCTCAA pLKO.1 1879 CDS 100% 4.050 3.240 N Nos1 n/a
5 TRCN0000340935 AGATCCAACCCAACGTCATTT pLKO_005 536 CDS 100% 13.200 9.240 N Nos1 n/a
6 TRCN0000340860 TGCTACAACCTCGCTACTATT pLKO_005 4115 CDS 100% 13.200 9.240 N Nos1 n/a
7 TRCN0000072127 GCCCTGGTGGAGATTAACATT pLKO.1 2392 CDS 100% 5.625 3.938 N Nos1 n/a
8 TRCN0000072126 CGACAATCCAAGATAGATCAT pLKO.1 4459 CDS 100% 4.950 3.465 N Nos1 n/a
9 TRCN0000340863 AGGAGCAAGGAGGCCATATTT pLKO_005 4628 CDS 100% 15.000 9.000 N Nos1 n/a
10 TRCN0000340938 TCAGGTCGGCCATCACTATAT pLKO_005 1871 CDS 100% 13.200 7.920 N Nos1 n/a
11 TRCN0000045423 GCCTTCATTGAAGAGAGCAAA pLKO.1 4849 CDS 100% 4.950 2.970 N NOS1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8126 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.