Transcript: Mouse XM_006530283.2

PREDICTED: Mus musculus T-box 5 (Tbx5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tbx5 (21388)
Length:
3414
CDS:
125..1681

Additional Resources:

NCBI RefSeq record:
XM_006530283.2
NBCI Gene record:
Tbx5 (21388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423529 CGCAGACGACCACAGATATAA pLKO_005 448 CDS 100% 15.000 21.000 N Tbx5 n/a
2 TRCN0000429758 CCCGATTACACATCGTGAAAG pLKO_005 666 CDS 100% 10.800 15.120 N Tbx5 n/a
3 TRCN0000084628 CGGTTCAAAGAACACTGCGTT pLKO.1 706 CDS 100% 2.640 3.696 N Tbx5 n/a
4 TRCN0000084629 GCTGATAACAAATGGTCCGTA pLKO.1 473 CDS 100% 2.640 2.112 N Tbx5 n/a
5 TRCN0000415240 CCAGCACTTCTCCGCTCATTT pLKO_005 1393 CDS 100% 13.200 9.240 N Tbx5 n/a
6 TRCN0000084630 GTTTCCTAGTTACAAAGTGAA pLKO.1 373 CDS 100% 4.950 3.465 N Tbx5 n/a
7 TRCN0000084631 GCCCAGGAGCACAGCCAAATT pLKO.1 1064 CDS 100% 4.400 3.080 N Tbx5 n/a
8 TRCN0000420807 ATATTCTTCTCATGGATATTG pLKO_005 423 CDS 100% 13.200 7.920 N Tbx5 n/a
9 TRCN0000084632 GCAGGGCCTGAGTACCTCTTA pLKO.1 1207 CDS 100% 1.650 0.990 N Tbx5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530283.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.