Transcript: Mouse XM_006530316.3

PREDICTED: Mus musculus 2'-5' oligoadenylate synthetase-like 2 (Oasl2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Oasl2 (23962)
Length:
2026
CDS:
379..1161

Additional Resources:

NCBI RefSeq record:
XM_006530316.3
NBCI Gene record:
Oasl2 (23962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313864 GCGACACCATCATACTCATTA pLKO_005 1127 CDS 100% 13.200 18.480 N Oasl2 n/a
2 TRCN0000075857 GACCCTGATGATACCATCTTA pLKO.1 988 CDS 100% 5.625 7.875 N Oasl2 n/a
3 TRCN0000313796 CAGTGCCTGAGACGTAAATAT pLKO_005 295 5UTR 100% 15.000 10.500 N Oasl2 n/a
4 TRCN0000075856 CCAAGAAGTCAGGGTGATTAA pLKO.1 91 5UTR 100% 13.200 9.240 N Oasl2 n/a
5 TRCN0000075854 CCTAGCAGATTATGGGATATT pLKO.1 873 CDS 100% 13.200 9.240 N Oasl2 n/a
6 TRCN0000075853 GCCTGGTCTATAGAGTGAGTT pLKO.1 1347 3UTR 100% 4.950 2.475 Y Oasl2 n/a
7 TRCN0000194517 GCCTGGTCTATAGAGTGAGTT pLKO.1 1347 3UTR 100% 4.950 2.475 Y Fbxo22 n/a
8 TRCN0000317452 GCCTGGTCTATAGAGTGAGTT pLKO_005 1347 3UTR 100% 4.950 2.475 Y Oasl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.