Transcript: Mouse XM_006530623.3

PREDICTED: Mus musculus cadherin 11 (Cdh11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh11 (12552)
Length:
4873
CDS:
264..2654

Additional Resources:

NCBI RefSeq record:
XM_006530623.3
NBCI Gene record:
Cdh11 (12552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329523 GAGCTGTAATTTCGCCTTAAA pLKO_005 3052 3UTR 100% 13.200 18.480 N Cdh11 n/a
2 TRCN0000329455 CCAATACCCTCACTATCAAAG pLKO_005 2017 CDS 100% 10.800 15.120 N Cdh11 n/a
3 TRCN0000329524 ATAACACTGCAGGAGTATATG pLKO_005 1906 CDS 100% 13.200 10.560 N Cdh11 n/a
4 TRCN0000094832 CCAAGTTATATCCATGAAGTT pLKO.1 1419 CDS 100% 4.950 3.960 N Cdh11 n/a
5 TRCN0000329453 TGACGGCATCAATGGATTTAT pLKO_005 2315 CDS 100% 15.000 10.500 N Cdh11 n/a
6 TRCN0000329454 TCAAACCTGAGTATCAGTATA pLKO_005 2350 CDS 100% 13.200 9.240 N Cdh11 n/a
7 TRCN0000094829 GCCAGCTTAAACCCATACAAT pLKO.1 3126 3UTR 100% 5.625 3.938 N Cdh11 n/a
8 TRCN0000094831 GCAGAAATTCACAACAGACAT pLKO.1 1644 CDS 100% 4.950 3.465 N Cdh11 n/a
9 TRCN0000094833 CCAAGATTTATCTTCAGCCTA pLKO.1 1836 CDS 100% 2.640 1.848 N Cdh11 n/a
10 TRCN0000094830 GCCGCCAATGTTCACATTGAT pLKO.1 1308 CDS 100% 0.563 0.394 N Cdh11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.