Transcript: Mouse XM_006530691.3

PREDICTED: Mus musculus adhesion G protein-coupled receptor G1 (Adgrg1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrg1 (14766)
Length:
3402
CDS:
165..2243

Additional Resources:

NCBI RefSeq record:
XM_006530691.3
NBCI Gene record:
Adgrg1 (14766)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279000 GTTGCTCTGGTAGGTAGATAC pLKO_005 2383 3UTR 100% 10.800 15.120 N Adgrg1 n/a
2 TRCN0000027988 CCCTCCACTATGATCAATCTT pLKO.1 313 CDS 100% 5.625 7.875 N Adgrg1 n/a
3 TRCN0000278999 CCCTCCACTATGATCAATCTT pLKO_005 313 CDS 100% 5.625 7.875 N Adgrg1 n/a
4 TRCN0000279001 TGGCGTTGGTGGATGTGAATA pLKO_005 1762 CDS 100% 13.200 9.240 N Adgrg1 n/a
5 TRCN0000027955 CCTGGGAGACACATTATCCTT pLKO.1 842 CDS 100% 3.000 2.100 N Adgrg1 n/a
6 TRCN0000027970 CTTCAGCATCATAACTTCCTT pLKO.1 2087 CDS 100% 3.000 2.100 N Adgrg1 n/a
7 TRCN0000027962 GCAGAACACCAAAGTCACCAA pLKO.1 1130 CDS 100% 2.640 1.848 N Adgrg1 n/a
8 TRCN0000278998 GCAGAACACCAAAGTCACCAA pLKO_005 1130 CDS 100% 2.640 1.848 N Adgrg1 n/a
9 TRCN0000027999 GCAAGCATGACTACCTGCTTA pLKO.1 496 CDS 100% 0.495 0.347 N Adgrg1 n/a
10 TRCN0000279066 GCAAGCATGACTACCTGCTTA pLKO_005 496 CDS 100% 0.495 0.347 N Adgrg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530691.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.