Transcript: Mouse XM_006530948.3

PREDICTED: Mus musculus kelch domain containing 4 (Klhdc4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhdc4 (234825)
Length:
2034
CDS:
319..1797

Additional Resources:

NCBI RefSeq record:
XM_006530948.3
NBCI Gene record:
Klhdc4 (234825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276972 ACGTCTATGGCGGCATGTTTG pLKO_005 1376 CDS 100% 10.800 15.120 N Klhdc4 n/a
2 TRCN0000201303 GACTACATCTACTACAGTGAT pLKO.1 643 CDS 100% 4.950 3.465 N Klhdc4 n/a
3 TRCN0000276974 GACTACATCTACTACAGTGAT pLKO_005 643 CDS 100% 4.950 3.465 N Klhdc4 n/a
4 TRCN0000192738 GATGATGCAGTTCAAGACATT pLKO.1 1759 CDS 100% 4.950 3.465 N Klhdc4 n/a
5 TRCN0000277026 GATGATGCAGTTCAAGACATT pLKO_005 1759 CDS 100% 4.950 3.465 N Klhdc4 n/a
6 TRCN0000202067 CGCAATGGTTTCACCATCACT pLKO.1 1802 3UTR 100% 3.000 2.100 N Klhdc4 n/a
7 TRCN0000276973 GAGTGGTCTTCTGTGAGCCTT pLKO_005 1854 3UTR 100% 2.640 1.848 N Klhdc4 n/a
8 TRCN0000189979 GCATAGCCATCTATGGAGGTT pLKO.1 770 CDS 100% 0.264 0.185 N Klhdc4 n/a
9 TRCN0000201665 GCAGAGAGTCAAGAAAGATGT pLKO.1 798 CDS 100% 4.950 2.970 N Klhdc4 n/a
10 TRCN0000285833 GCAGAGAGTCAAGAAAGATGT pLKO_005 798 CDS 100% 4.950 2.970 N Klhdc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.