Transcript: Mouse XM_006531152.1

PREDICTED: Mus musculus carboxylesterase 1B (Ces1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ces1b (382044)
Length:
1926
CDS:
106..1764

Additional Resources:

NCBI RefSeq record:
XM_006531152.1
NBCI Gene record:
Ces1b (382044)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251801 TGTATTTGGGATTCCATTATT pLKO_005 1482 CDS 100% 15.000 10.500 N Ces1b n/a
2 TRCN0000251800 CAGATTCAGTGACCGTCTTTG pLKO_005 740 CDS 100% 10.800 7.560 N Ces1b n/a
3 TRCN0000251797 GGCGGAGCATCACTCTATAAT pLKO_005 544 CDS 100% 15.000 9.000 N Ces1b n/a
4 TRCN0000251799 ATGCTGGAGTGTCAACCTATA pLKO_005 1376 CDS 100% 10.800 6.480 N Ces1b n/a
5 TRCN0000032049 TGGGAGGCTCTGCCAGTCTCA pLKO.1 1766 3UTR 100% 0.000 0.000 Y Ces1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.