Transcript: Mouse XM_006531234.1

PREDICTED: Mus musculus thymidine kinase 2, mitochondrial (Tk2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tk2 (57813)
Length:
2746
CDS:
627..1187

Additional Resources:

NCBI RefSeq record:
XM_006531234.1
NBCI Gene record:
Tk2 (57813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361811 TAGGAGGGTCTGTTATCTAAT pLKO_005 1272 3UTR 100% 13.200 18.480 N Tk2 n/a
2 TRCN0000361745 TCTGCGAACCACTCCCGAAAT pLKO_005 932 CDS 100% 10.800 15.120 N Tk2 n/a
3 TRCN0000025639 CCGGATATTAACTCCAGAGAA pLKO.1 1148 CDS 100% 4.950 6.930 N Tk2 n/a
4 TRCN0000368799 GTTGATGGAAAGGTCAATTTA pLKO_005 779 CDS 100% 15.000 10.500 N Tk2 n/a
5 TRCN0000025640 CCTGTGCTCAAGTGGAGAAAT pLKO.1 633 CDS 100% 13.200 9.240 N Tk2 n/a
6 TRCN0000025643 CGGTTGATGGAAAGGTCAATT pLKO.1 777 CDS 100% 13.200 9.240 N Tk2 n/a
7 TRCN0000006392 CCTGTATAGAAGTGGGAAGAT pLKO.1 827 CDS 100% 4.950 3.465 N TK2 n/a
8 TRCN0000338423 CCTGTATAGAAGTGGGAAGAT pLKO_005 827 CDS 100% 4.950 3.465 N TK2 n/a
9 TRCN0000025641 GCTGACCACAACTTGGAGAAA pLKO.1 1098 CDS 100% 4.950 3.465 N Tk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.