Transcript: Mouse XM_006531446.3

PREDICTED: Mus musculus RIKEN cDNA 4930432K21 gene (4930432K21Rik), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930432K21Rik (74666)
Length:
2221
CDS:
205..1917

Additional Resources:

NCBI RefSeq record:
XM_006531446.3
NBCI Gene record:
4930432K21Rik (74666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234802 CGGTCTGAACCGGCTGATTAT pLKO_005 1782 CDS 100% 13.200 18.480 N 4930432K21Rik n/a
2 TRCN0000234801 GCTGGAGATTCCGGCCATATA pLKO_005 1204 CDS 100% 13.200 18.480 N 4930432K21Rik n/a
3 TRCN0000234803 AGAGCTGGAGGGACTTGTAAT pLKO_005 1898 CDS 100% 13.200 9.240 N 4930432K21Rik n/a
4 TRCN0000234804 CACTTGGCCAGGATCACTATT pLKO_005 1979 3UTR 100% 13.200 9.240 N 4930432K21Rik n/a
5 TRCN0000234800 GACAATCTCACTAGATAATAG pLKO_005 618 CDS 100% 13.200 9.240 N 4930432K21Rik n/a
6 TRCN0000180300 CCACAGTTCAAGACAGTAGTA pLKO.1 668 CDS 100% 4.950 3.465 N 4930432K21Rik n/a
7 TRCN0000184804 CACTAACATGGAGCAGGGTTT pLKO.1 1584 CDS 100% 4.050 2.835 N 4930432K21Rik n/a
8 TRCN0000196033 GCCTGAGCTTTAAGGAAGTCA pLKO.1 2019 3UTR 100% 3.000 2.100 N 4930432K21Rik n/a
9 TRCN0000184006 CAGGATCACTATTGCTCCCAT pLKO.1 1987 3UTR 100% 2.640 1.848 N 4930432K21Rik n/a
10 TRCN0000195984 CCATTCACACTACTCCAGAGA pLKO.1 213 CDS 100% 2.640 1.848 N 4930432K21Rik n/a
11 TRCN0000184073 CCACATATACTCTCAGCAGCA pLKO.1 881 CDS 100% 2.160 1.512 N 4930432K21Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.