Transcript: Mouse XM_006531680.3

PREDICTED: Mus musculus phosphatidylinositol transfer protein, membrane-associated 1 (Pitpnm1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pitpnm1 (18739)
Length:
2822
CDS:
245..2764

Additional Resources:

NCBI RefSeq record:
XM_006531680.3
NBCI Gene record:
Pitpnm1 (18739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441337 AGTGGCGCATGCAGAACATTG pLKO_005 1239 CDS 100% 10.800 7.560 N PITPNM1 n/a
2 TRCN0000100732 GCAAACCCATTCGAGTCTCTT pLKO.1 2569 CDS 100% 4.950 3.465 N Pitpnm1 n/a
3 TRCN0000332135 GCAAACCCATTCGAGTCTCTT pLKO_005 2569 CDS 100% 4.950 3.465 N Pitpnm1 n/a
4 TRCN0000029760 GCCTATAAGCTGTGCAAGGTT pLKO.1 809 CDS 100% 3.000 2.100 N PITPNM1 n/a
5 TRCN0000100733 CAGCTCTACATGATCCAGAAA pLKO.1 305 CDS 100% 4.950 2.970 N Pitpnm1 n/a
6 TRCN0000332136 CAGCTCTACATGATCCAGAAA pLKO_005 305 CDS 100% 4.950 2.970 N Pitpnm1 n/a
7 TRCN0000029762 CAAGGAGATGACCAAGTGGAA pLKO.1 1339 CDS 100% 2.640 1.584 N PITPNM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.