Transcript: Mouse XM_006531705.3

PREDICTED: Mus musculus spectrin beta, non-erythrocytic 2 (Sptbn2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sptbn2 (20743)
Length:
7900
CDS:
103..7269

Additional Resources:

NCBI RefSeq record:
XM_006531705.3
NBCI Gene record:
Sptbn2 (20743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089984 GCCCAGCAATTCTATCGTGAT pLKO.1 4870 CDS 100% 4.050 5.670 N Sptbn2 n/a
2 TRCN0000325832 GCCCAGCAATTCTATCGTGAT pLKO_005 4870 CDS 100% 4.050 5.670 N Sptbn2 n/a
3 TRCN0000089987 GCAGTGGATTGAGCAAACGAT pLKO.1 1056 CDS 100% 3.000 4.200 N Sptbn2 n/a
4 TRCN0000325900 GCAGTGGATTGAGCAAACGAT pLKO_005 1056 CDS 100% 3.000 4.200 N Sptbn2 n/a
5 TRCN0000089983 CCTTCTCTTCTGCTATTTAAT pLKO.1 7437 3UTR 100% 15.000 10.500 N Sptbn2 n/a
6 TRCN0000325903 CCTTCTCTTCTGCTATTTAAT pLKO_005 7437 3UTR 100% 15.000 10.500 N Sptbn2 n/a
7 TRCN0000089986 CGAAGTAGAGAGCCTCATCAA pLKO.1 6240 CDS 100% 4.950 3.465 N Sptbn2 n/a
8 TRCN0000353998 CGAAGTAGAGAGCCTCATCAA pLKO_005 6240 CDS 100% 4.950 3.465 N Sptbn2 n/a
9 TRCN0000089985 GCCCAGACCATCAAACAACTA pLKO.1 5023 CDS 100% 4.950 3.465 N Sptbn2 n/a
10 TRCN0000325830 GCCCAGACCATCAAACAACTA pLKO_005 5023 CDS 100% 4.950 3.465 N Sptbn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531705.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.