Transcript: Mouse XM_006531792.1

PREDICTED: Mus musculus protein phosphatase 6, regulatory subunit 3 (Ppp6r3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp6r3 (52036)
Length:
4934
CDS:
259..2862

Additional Resources:

NCBI RefSeq record:
XM_006531792.1
NBCI Gene record:
Ppp6r3 (52036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240830 ATCCGATACAAGTATCCAAAT pLKO_005 475 CDS 100% 10.800 15.120 N Ppp6r3 n/a
2 TRCN0000240828 AGTATCACTGATGGCTATTTC pLKO_005 3721 3UTR 100% 13.200 9.240 N Ppp6r3 n/a
3 TRCN0000240826 GATGTTCTGAATTGGCTAAAT pLKO_005 799 CDS 100% 13.200 9.240 N Ppp6r3 n/a
4 TRCN0000240829 TGAACAGCATTGGCGTCATAT pLKO_005 1364 CDS 100% 13.200 9.240 N Ppp6r3 n/a
5 TRCN0000191920 GCTACAACTTAGTTGATGAAT pLKO.1 3501 3UTR 100% 5.625 3.938 N Ppp6r3 n/a
6 TRCN0000200809 GCAAGCTCATAGAATTTCTGT pLKO.1 383 CDS 100% 3.000 2.100 N Ppp6r3 n/a
7 TRCN0000192655 GCCTCACAATCACTTTGTGAA pLKO.1 889 CDS 100% 0.495 0.347 N Ppp6r3 n/a
8 TRCN0000160381 CAAGGTGCTAAGTATTCTTAT pLKO.1 633 CDS 100% 13.200 7.920 N PPP6R3 n/a
9 TRCN0000161015 GAATACTTGAAGCCTGGGAAA pLKO.1 1565 CDS 100% 4.050 2.835 N PPP6R3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15896 pDONR223 0% 20.1% 20.9% None (many diffs) n/a
2 ccsbBroad304_15896 pLX_304 0% 20.1% 20.9% V5 (many diffs) n/a
Download CSV