Transcript: Mouse XM_006531840.1

PREDICTED: Mus musculus RIKEN cDNA 1810055G02 gene (1810055G02Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1810055G02Rik (72056)
Length:
1915
CDS:
448..1626

Additional Resources:

NCBI RefSeq record:
XM_006531840.1
NBCI Gene record:
1810055G02Rik (72056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173164 CAAGTGGCCTAAAGCAGTAAA pLKO.1 540 CDS 100% 13.200 9.240 N 1810055G02Rik n/a
2 TRCN0000328038 CAAGTGGCCTAAAGCAGTAAA pLKO_005 540 CDS 100% 13.200 9.240 N 1810055G02Rik n/a
3 TRCN0000328042 GCCCTGATGTAGACGTCATAT pLKO_005 1220 CDS 100% 13.200 9.240 N 1810055G02Rik n/a
4 TRCN0000193919 CTATGAGAGCTACAAGAAGAA pLKO.1 1548 CDS 100% 4.950 3.465 N 1810055G02Rik n/a
5 TRCN0000328039 CTATGAGAGCTACAAGAAGAA pLKO_005 1548 CDS 100% 4.950 3.465 N 1810055G02Rik n/a
6 TRCN0000173245 CCAAACTAAGTGCTTCCAGAT pLKO.1 1677 3UTR 100% 4.050 2.835 N 1810055G02Rik n/a
7 TRCN0000328040 CCAAACTAAGTGCTTCCAGAT pLKO_005 1677 3UTR 100% 4.050 2.835 N 1810055G02Rik n/a
8 TRCN0000174424 CACATTTAATAGCTGTCAGAT pLKO.1 1736 3UTR 100% 4.950 2.970 N 1810055G02Rik n/a
9 TRCN0000328041 CACATTTAATAGCTGTCAGAT pLKO_005 1736 3UTR 100% 4.950 2.970 N 1810055G02Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.