Transcript: Mouse XM_006531984.3

PREDICTED: Mus musculus active BCR-related gene (Abr), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abr (109934)
Length:
3659
CDS:
359..1309

Additional Resources:

NCBI RefSeq record:
XM_006531984.3
NBCI Gene record:
Abr (109934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531984.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348195 GGTATGGGCACAGACAGATTG pLKO_005 1612 3UTR 100% 10.800 15.120 N Abr n/a
2 TRCN0000105835 GCTAAGTCTAAACAAGGGTTT pLKO.1 2863 3UTR 100% 4.050 5.670 N Abr n/a
3 TRCN0000374405 TTTCTCCCAGCACTCACTTTC pLKO_005 1646 3UTR 100% 10.800 7.560 N Abr n/a
4 TRCN0000105837 CCATCAGAAGTGGAGAGCAAA pLKO.1 1148 CDS 100% 4.950 3.465 N Abr n/a
5 TRCN0000334064 CCATCAGAAGTGGAGAGCAAA pLKO_005 1148 CDS 100% 4.950 3.465 N Abr n/a
6 TRCN0000105836 CCCATCAACAAGATGTCACTT pLKO.1 1088 CDS 100% 4.950 3.465 N Abr n/a
7 TRCN0000334063 CCCATCAACAAGATGTCACTT pLKO_005 1088 CDS 100% 4.950 3.465 N Abr n/a
8 TRCN0000105839 GAAGCGGAACACACTGTACTT pLKO.1 1273 CDS 100% 4.950 3.465 N Abr n/a
9 TRCN0000334065 GAAGCGGAACACACTGTACTT pLKO_005 1273 CDS 100% 4.950 3.465 N Abr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531984.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.