Transcript: Mouse XM_006532100.2

PREDICTED: Mus musculus chromobox 1 (Cbx1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cbx1 (12412)
Length:
1621
CDS:
713..1270

Additional Resources:

NCBI RefSeq record:
XM_006532100.2
NBCI Gene record:
Cbx1 (12412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062224 CCCACAGGTTGTCATATCCTT pLKO.1 1180 CDS 100% 3.000 2.400 N CBX1 n/a
2 TRCN0000290222 CCCACAGGTTGTCATATCCTT pLKO_005 1180 CDS 100% 3.000 2.400 N CBX1 n/a
3 TRCN0000071029 TCTTCTAAAGTGGAAGGGTTT pLKO.1 826 CDS 100% 4.050 2.835 N Cbx1 n/a
4 TRCN0000298344 TCTTCTAAAGTGGAAGGGTTT pLKO_005 826 CDS 100% 4.050 2.835 N Cbx1 n/a
5 TRCN0000071030 CAGAGCGGATTATTGGAGCTA pLKO.1 1068 CDS 100% 2.640 1.848 N Cbx1 n/a
6 TRCN0000298347 CAGAGCGGATTATTGGAGCTA pLKO_005 1068 CDS 100% 2.640 1.848 N Cbx1 n/a
7 TRCN0000071032 GAGGTACTAGAAGAAGAGGAA pLKO.1 746 CDS 100% 2.640 1.848 N Cbx1 n/a
8 TRCN0000071031 GAGTTTCTACAGTCACAGAAA pLKO.1 908 CDS 100% 0.495 0.347 N Cbx1 n/a
9 TRCN0000287389 GAGTTTCTACAGTCACAGAAA pLKO_005 908 CDS 100% 0.495 0.347 N Cbx1 n/a
10 TRCN0000071028 CCTGACCTTATTGCTGAGTTT pLKO.1 893 CDS 100% 4.950 2.970 N Cbx1 n/a
11 TRCN0000298343 CCTGACCTTATTGCTGAGTTT pLKO_005 893 CDS 100% 4.950 2.970 N Cbx1 n/a
12 TRCN0000062225 GAAGAGGAATATGTGGTGGAA pLKO.1 764 CDS 100% 2.640 1.584 N CBX1 n/a
13 TRCN0000290220 GAAGAGGAATATGTGGTGGAA pLKO_005 764 CDS 100% 2.640 1.584 N CBX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532100.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.