Transcript: Mouse XM_006532108.1

PREDICTED: Mus musculus chaperonin containing Tcp1, subunit 6b (zeta) (Cct6b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cct6b (12467)
Length:
1514
CDS:
30..1412

Additional Resources:

NCBI RefSeq record:
XM_006532108.1
NBCI Gene record:
Cct6b (12467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439972 TGAACTGGCCGACATACTAAC pLKO_005 515 CDS 100% 10.800 15.120 N Cct6b n/a
2 TRCN0000445885 TTCACTCTTGCACGGTGATTG pLKO_005 1330 CDS 100% 10.800 15.120 N Cct6b n/a
3 TRCN0000120463 CCAAATAAGCATACTCTCATA pLKO.1 951 CDS 100% 4.950 6.930 N Cct6b n/a
4 TRCN0000437299 GCCTGCACCCTAGAATCATAA pLKO_005 367 CDS 100% 13.200 10.560 N Cct6b n/a
5 TRCN0000434440 AGCAGGAATCTGGGATAATTA pLKO_005 1289 CDS 100% 15.000 10.500 N Cct6b n/a
6 TRCN0000120464 GATCTCTTCATGGTGGAAATT pLKO.1 588 CDS 100% 13.200 9.240 N Cct6b n/a
7 TRCN0000434213 GATCATTGGAGAGTTGCTAAA pLKO_005 320 CDS 100% 10.800 7.560 N Cct6b n/a
8 TRCN0000120465 AGACGAAAGCACTTGAAGTTT pLKO.1 409 CDS 100% 5.625 3.938 N Cct6b n/a
9 TRCN0000120462 CGATAGCAGAAGCTCTTGTTA pLKO.1 1066 CDS 100% 5.625 3.938 N Cct6b n/a
10 TRCN0000120466 CTCACCAAAGACGGCAATGTA pLKO.1 195 CDS 100% 5.625 3.938 N Cct6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.