Transcript: Mouse XM_006532149.3

PREDICTED: Mus musculus discs, large homolog 4 (Drosophila) (Dlg4), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dlg4 (13385)
Length:
2925
CDS:
4..2085

Additional Resources:

NCBI RefSeq record:
XM_006532149.3
NBCI Gene record:
Dlg4 (13385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235628 ACGATCATCGCTCAGTATAAA pLKO_005 1069 CDS 100% 15.000 21.000 N DLG4 n/a
2 TRCN0000221741 ACACGTCCTAAGCGGGAATAT pLKO.1 1609 CDS 100% 13.200 18.480 N Dlg4 n/a
3 TRCN0000321801 ACACGTCCTAAGCGGGAATAT pLKO_005 1609 CDS 100% 13.200 18.480 N Dlg4 n/a
4 TRCN0000221738 GCTAGAGATCAATAAGCGGAT pLKO.1 1884 CDS 100% 2.160 3.024 N Dlg4 n/a
5 TRCN0000235627 ACGAGAGTGGTCAAGGTTAAA pLKO_005 1398 CDS 100% 13.200 10.560 N DLG4 n/a
6 TRCN0000321881 ACGAGAGTGGTCAAGGTTAAA pLKO_005 1398 CDS 100% 13.200 10.560 N Dlg4 n/a
7 TRCN0000321866 CCGTTTGAGTTCTCCTTTATT pLKO_005 2542 3UTR 100% 15.000 10.500 N Dlg4 n/a
8 TRCN0000321865 AGACATCACAACCTCATATTC pLKO_005 684 CDS 100% 13.200 9.240 N Dlg4 n/a
9 TRCN0000221739 GCAGCCCTGAAGAACACATAT pLKO.1 598 CDS 100% 13.200 9.240 N Dlg4 n/a
10 TRCN0000221737 CCCTGGAGATAATAGCATCTA pLKO.1 459 CDS 100% 4.950 3.465 N Dlg4 n/a
11 TRCN0000221740 GATCAGTCATAGCAGCTACTT pLKO.1 723 CDS 100% 4.950 3.465 N Dlg4 n/a
12 TRCN0000321800 GATCAGTCATAGCAGCTACTT pLKO_005 723 CDS 100% 4.950 3.465 N Dlg4 n/a
13 TRCN0000006115 GTCACGATCATCGCTCAGTAT pLKO.1 1066 CDS 100% 4.950 3.465 N DLG4 n/a
14 TRCN0000006111 GCATGAGTGGAAGGTCTAAAT pLKO.1 2673 3UTR 100% 13.200 9.240 N DLG4 n/a
15 TRCN0000235625 TGCATGAGTGGAAGGTCTAAA pLKO_005 2672 3UTR 100% 13.200 9.240 N DLG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.