Transcript: Mouse XM_006532276.3

PREDICTED: Mus musculus hyaluronan mediated motility receptor (RHAMM) (Hmmr), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hmmr (15366)
Length:
2571
CDS:
105..2426

Additional Resources:

NCBI RefSeq record:
XM_006532276.3
NBCI Gene record:
Hmmr (15366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312846 ACTGCCTAGTCTTAGGTATAT pLKO_005 2547 3UTR 100% 13.200 18.480 N Hmmr n/a
2 TRCN0000071589 GCTATAAGTCATCAACACTTA pLKO.1 1675 CDS 100% 0.495 0.693 N Hmmr n/a
3 TRCN0000311867 GCTATAAGTCATCAACACTTA pLKO_005 1675 CDS 100% 0.495 0.693 N Hmmr n/a
4 TRCN0000071590 CGAGCTACTAAAGGCTAAGTT pLKO.1 548 CDS 100% 5.625 4.500 N Hmmr n/a
5 TRCN0000071588 GCCAGCTACTTGAAACAGAAA pLKO.1 982 CDS 100% 4.950 3.960 N Hmmr n/a
6 TRCN0000311803 GCCAGCTACTTGAAACAGAAA pLKO_005 982 CDS 100% 4.950 3.960 N Hmmr n/a
7 TRCN0000071592 GACTCTCAGAAGAATGATAAA pLKO.1 333 CDS 100% 13.200 9.240 N Hmmr n/a
8 TRCN0000311865 GACTCTCAGAAGAATGATAAA pLKO_005 333 CDS 100% 13.200 9.240 N Hmmr n/a
9 TRCN0000071591 CAGGCATTGTTGAATGAACAT pLKO.1 2106 CDS 100% 4.950 3.465 N Hmmr n/a
10 TRCN0000311805 CAGGCATTGTTGAATGAACAT pLKO_005 2106 CDS 100% 4.950 3.465 N Hmmr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.