Transcript: Mouse XM_006532291.2

PREDICTED: Mus musculus homeobox B3 (Hoxb3), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hoxb3 (15410)
Length:
3467
CDS:
638..1936

Additional Resources:

NCBI RefSeq record:
XM_006532291.2
NBCI Gene record:
Hoxb3 (15410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413805 ACCCTCACCAAACAGATATTC pLKO_005 1007 CDS 100% 13.200 18.480 N HOXB3 n/a
2 TRCN0000070845 CACCCTCACCAAACAGATATT pLKO.1 1006 CDS 100% 13.200 18.480 N Hoxb3 n/a
3 TRCN0000015645 GCCGGCTTCATGAACGCCTTA pLKO.1 1460 CDS 100% 1.350 1.890 N HOXB3 n/a
4 TRCN0000425831 AGAAGCACATTCAACACTTAA pLKO_005 2312 3UTR 100% 13.200 9.240 N Hoxb3 n/a
5 TRCN0000417694 ATCAGCAAGCAATCAACTTAC pLKO_005 2343 3UTR 100% 10.800 7.560 N Hoxb3 n/a
6 TRCN0000070843 ACCTACCAGTACCACTAGCAA pLKO.1 922 CDS 100% 3.000 2.100 N Hoxb3 n/a
7 TRCN0000070847 TGGCAGCAATGGTTTCGGCTA pLKO.1 703 CDS 100% 2.160 1.512 N Hoxb3 n/a
8 TRCN0000070846 CCAACCAGCATCATGGACCCT pLKO.1 1824 CDS 100% 0.220 0.154 N Hoxb3 n/a
9 TRCN0000070844 CGTCGCATGAAGTACAAGAAA pLKO.1 1358 CDS 100% 5.625 2.813 Y Hoxb3 n/a
10 TRCN0000070446 CCGTCGCATGAAGTACAAGAA pLKO.1 1357 CDS 100% 4.950 2.475 Y Hoxd3 n/a
11 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 1336 CDS 100% 4.050 2.025 Y Hoxa3 n/a
12 TRCN0000015647 GAATCCAAGAAGCGCCCAAAT pLKO.1 1902 CDS 100% 10.800 7.560 N HOXB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.