Transcript: Mouse XM_006532302.1

PREDICTED: Mus musculus solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 (Slc6a4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc6a4 (15567)
Length:
2779
CDS:
320..2032

Additional Resources:

NCBI RefSeq record:
XM_006532302.1
NBCI Gene record:
Slc6a4 (15567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234073 ACACTTAAGGAGCGCATTATT pLKO_005 2025 CDS 100% 15.000 21.000 N Slc6a4 n/a
2 TRCN0000219024 GATGTCTTGCTAGCCATATAT pLKO_005 2518 3UTR 100% 15.000 21.000 N Slc6a4 n/a
3 TRCN0000234071 TATATCGCCTCCTACTATAAC pLKO_005 830 CDS 100% 13.200 18.480 N Slc6a4 n/a
4 TRCN0000070115 GCATCCCTATATACATCATTT pLKO.1 1981 CDS 100% 13.200 10.560 N Slc6a4 n/a
5 TRCN0000070116 CATGTTAATCACGCTGGGTTT pLKO.1 1606 CDS 100% 4.050 3.240 N Slc6a4 n/a
6 TRCN0000234072 TGTCATCTGCATCCCTATATA pLKO_005 1973 CDS 100% 15.000 10.500 N Slc6a4 n/a
7 TRCN0000234074 CCTGAAACACCAACGGAAATT pLKO_005 2058 3UTR 100% 13.200 9.240 N Slc6a4 n/a
8 TRCN0000070117 CTCCTGAAACACCAACGGAAA pLKO.1 2056 3UTR 100% 4.050 2.835 N Slc6a4 n/a
9 TRCN0000070114 GCTGTCAGAGTGTAAGGACAA pLKO.1 352 CDS 100% 4.050 2.835 N Slc6a4 n/a
10 TRCN0000070113 CGCCTCCTACTATAACACCAT pLKO.1 835 CDS 100% 2.640 1.848 N Slc6a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.