Transcript: Mouse XM_006532386.2

PREDICTED: Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (Galnt10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Galnt10 (171212)
Length:
4871
CDS:
206..2098

Additional Resources:

NCBI RefSeq record:
XM_006532386.2
NBCI Gene record:
Galnt10 (171212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093675 GATGGATGAATACGCAGAATA pLKO.1 1477 CDS 100% 13.200 9.240 N Galnt10 n/a
2 TRCN0000093677 CCTCAGCACACCAAGAAGTTT pLKO.1 1832 CDS 100% 5.625 3.938 N Galnt10 n/a
3 TRCN0000093676 GCTGAAGGACTGGCATAACAA pLKO.1 496 CDS 100% 5.625 3.938 N Galnt10 n/a
4 TRCN0000093674 CCCGATTCATTCCATCCTCAT pLKO.1 3825 3UTR 100% 4.050 2.835 N Galnt10 n/a
5 TRCN0000093678 CCCAAACTGTAACAGCAAGCT pLKO.1 682 CDS 100% 2.640 1.848 N Galnt10 n/a
6 TRCN0000035573 CTACAGGAAGTATGTGCCCTA pLKO.1 1399 CDS 100% 2.160 1.296 N GALNT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.