Transcript: Mouse XM_006532402.3

PREDICTED: Mus musculus max binding protein (Mnt), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mnt (17428)
Length:
4687
CDS:
549..2282

Additional Resources:

NCBI RefSeq record:
XM_006532402.3
NBCI Gene record:
Mnt (17428)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235811 ACGACAAGAAGACTTCGAATC pLKO_005 1264 CDS 100% 6.000 4.800 N Mnt n/a
2 TRCN0000085736 CTGTCGCACCAGCAAGTAAAT pLKO.1 2103 CDS 100% 13.200 9.240 N Mnt n/a
3 TRCN0000235813 GCTCACTGCCTGGGATCTTTA pLKO_005 4208 3UTR 100% 13.200 9.240 N Mnt n/a
4 TRCN0000235815 TGTCGCACCAGCAAGTAAATG pLKO_005 2104 CDS 100% 13.200 9.240 N Mnt n/a
5 TRCN0000235814 CACCGGCTGAAGAAGCCAAAT pLKO_005 1159 CDS 100% 10.800 7.560 N Mnt n/a
6 TRCN0000085734 CCACTGACTGTCATTCCTATT pLKO.1 807 CDS 100% 10.800 7.560 N Mnt n/a
7 TRCN0000085733 CCGAATGACTATGTCCAGATT pLKO.1 3951 3UTR 100% 4.950 3.465 N Mnt n/a
8 TRCN0000085737 GACGACAAGAAGACTTCGAAT pLKO.1 1263 CDS 100% 4.950 3.465 N Mnt n/a
9 TRCN0000235812 CTATTCCTGTAGTGACCAATT pLKO_005 823 CDS 100% 10.800 6.480 N Mnt n/a
10 TRCN0000085735 CCTATTCCTGTAGTGACCAAT pLKO.1 822 CDS 100% 4.950 2.970 N Mnt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.