Transcript: Mouse XM_006532437.3

PREDICTED: Mus musculus neurofibromatosis 1 (Nf1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nf1 (18015)
Length:
13064
CDS:
1612..10167

Additional Resources:

NCBI RefSeq record:
XM_006532437.3
NBCI Gene record:
Nf1 (18015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034342 GCCAACCTTAACCTCTCTAAT pLKO.1 9967 CDS 100% 13.200 10.560 N Nf1 n/a
2 TRCN0000034341 CCCTTCTTCTTACTGATATTT pLKO.1 9023 CDS 100% 15.000 10.500 N Nf1 n/a
3 TRCN0000034343 CCAAGCTAGAAGTGGCCTTAT pLKO.1 3698 CDS 100% 10.800 7.560 N Nf1 n/a
4 TRCN0000039717 GCTGGCAGTTTCAAACGTAAT pLKO.1 10126 CDS 100% 10.800 7.560 N NF1 n/a
5 TRCN0000034339 CCCTGTAAATAGTTTGTGTAA pLKO.1 12917 3UTR 100% 4.950 3.465 N Nf1 n/a
6 TRCN0000039715 CCTCACAACAACCAACACTTT pLKO.1 2773 CDS 100% 4.950 3.465 N NF1 n/a
7 TRCN0000039716 CCTGACACTTACAACAGTCAA pLKO.1 8488 CDS 100% 4.950 3.465 N NF1 n/a
8 TRCN0000034340 CGGATGAATTTACAAAGCTAT pLKO.1 2294 CDS 100% 4.950 3.465 N Nf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.