Transcript: Mouse XM_006532519.3

PREDICTED: Mus musculus cytohesin 1 (Cyth1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyth1 (19157)
Length:
3254
CDS:
389..1408

Additional Resources:

NCBI RefSeq record:
XM_006532519.3
NBCI Gene record:
Cyth1 (19157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110115 CCACGCACTATAAAGATTTAT pLKO.1 1813 3UTR 100% 15.000 21.000 N Cyth1 n/a
2 TRCN0000328920 AGAGAAGCCACGCACTATAAA pLKO_005 1806 3UTR 100% 15.000 12.000 N Cyth1 n/a
3 TRCN0000381915 GACTGCAGAAGAGCGTCAAGA pLKO_005 247 5UTR 100% 4.950 3.960 N Cyth1 n/a
4 TRCN0000110118 TGAGCTTTATATCCCTGACAA pLKO.1 1183 CDS 100% 4.950 3.960 N Cyth1 n/a
5 TRCN0000379642 AGCAGAAGTTGCTAATGAAAT pLKO_005 334 5UTR 100% 13.200 9.240 N Cyth1 n/a
6 TRCN0000328917 AGCTTTATATCCCTGACAATA pLKO_005 1185 CDS 100% 13.200 9.240 N Cyth1 n/a
7 TRCN0000328918 TCCTGTCCTTCGCAATCATAA pLKO_005 774 CDS 100% 13.200 9.240 N Cyth1 n/a
8 TRCN0000380204 AGCTGCTCCGGAATCTCTATG pLKO_005 900 CDS 100% 10.800 7.560 N Cyth1 n/a
9 TRCN0000328921 TCCAGTTCTTAATCGAGAATG pLKO_005 453 CDS 100% 10.800 7.560 N Cyth1 n/a
10 TRCN0000110119 CCAGGTGATTAAGGCCTGTAA pLKO.1 1210 CDS 100% 4.950 3.465 N Cyth1 n/a
11 TRCN0000110117 GCGTCAAGAACTGGAGAACAT pLKO.1 259 5UTR 100% 4.950 3.465 N Cyth1 n/a
12 TRCN0000110116 CCGGAATCTCTATGAGAGCAT pLKO.1 907 CDS 100% 2.640 1.848 N Cyth1 n/a
13 TRCN0000381208 TGCTCCGAGAATGCCTGTAAG pLKO_005 1748 3UTR 100% 10.800 6.480 N Cyth1 n/a
14 TRCN0000328919 TTGAATACACCACGGACAAAG pLKO_005 1089 CDS 100% 10.800 6.480 N Cyth1 n/a
15 TRCN0000062115 CGGAATCTCTATGAGAGCATA pLKO.1 908 CDS 100% 4.950 3.465 N CYTH1 n/a
16 TRCN0000230432 CCATGAACCGAGGCATCAATG pLKO_005 858 CDS 100% 10.800 5.400 Y CYTH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.