Transcript: Mouse XM_006532549.3

PREDICTED: Mus musculus Rho GDP dissociation inhibitor (GDI) alpha (Arhgdia), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgdia (192662)
Length:
2017
CDS:
276..890

Additional Resources:

NCBI RefSeq record:
XM_006532549.3
NBCI Gene record:
Arhgdia (192662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106161 GAGTGGAATCTCACCATCAAA pLKO.1 852 CDS 100% 5.625 3.938 N Arhgdia n/a
2 TRCN0000316502 GAGTGGAATCTCACCATCAAA pLKO_005 852 CDS 100% 5.625 3.938 N Arhgdia n/a
3 TRCN0000106164 AGCTTCAAGAAACAGTCGTTT pLKO.1 561 CDS 100% 4.950 3.465 N Arhgdia n/a
4 TRCN0000316503 AGCTTCAAGAAACAGTCGTTT pLKO_005 561 CDS 100% 4.950 3.465 N Arhgdia n/a
5 TRCN0000106162 CAGTCGTTTGTCTTGAAGGAA pLKO.1 573 CDS 100% 3.000 2.100 N Arhgdia n/a
6 TRCN0000316589 CAGTCGTTTGTCTTGAAGGAA pLKO_005 573 CDS 100% 3.000 2.100 N Arhgdia n/a
7 TRCN0000106163 TCCGGCATGAAGTACATCCAA pLKO.1 645 CDS 100% 3.000 2.100 N Arhgdia n/a
8 TRCN0000106160 GCCTGGCCTGTCAGTATTTAT pLKO.1 1743 3UTR 100% 15.000 9.000 N Arhgdia n/a
9 TRCN0000316501 GCCTGGCCTGTCAGTATTTAT pLKO_005 1743 3UTR 100% 15.000 9.000 N Arhgdia n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.