Transcript: Mouse XM_006532708.3

PREDICTED: Mus musculus benzodiazepine receptor associated protein 1 (Bzrap1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspoap1 (207777)
Length:
6486
CDS:
512..5470

Additional Resources:

NCBI RefSeq record:
XM_006532708.3
NBCI Gene record:
Tspoap1 (207777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532708.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248301 GAGGTGACTGTACGCACTATG pLKO_005 2894 CDS 100% 10.800 15.120 N Tspoap1 n/a
2 TRCN0000202248 GTTCCATCCAACTTCCTGGAA pLKO.1 5216 CDS 100% 0.264 0.211 N Tspoap1 n/a
3 TRCN0000257698 GTGGCTGCATTTGACTATAAT pLKO_005 5063 CDS 100% 15.000 10.500 N Tspoap1 n/a
4 TRCN0000257696 TGAGGGAAAGGACGGATTTAT pLKO_005 6231 3UTR 100% 15.000 10.500 N Tspoap1 n/a
5 TRCN0000189484 CAACTCCTCAAGGTGTTTGGA pLKO.1 4691 CDS 100% 3.000 2.100 N Tspoap1 n/a
6 TRCN0000248302 CCCAGAAGAAGCCAAGTATTG pLKO_005 3351 CDS 100% 10.800 6.480 N Tspoap1 n/a
7 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 3506 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532708.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.