Transcript: Mouse XM_006532857.1

PREDICTED: Mus musculus NLR family, pyrin domain containing 3 (Nlrp3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlrp3 (216799)
Length:
3932
CDS:
139..3240

Additional Resources:

NCBI RefSeq record:
XM_006532857.1
NBCI Gene record:
Nlrp3 (216799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101067 CCAGGAGAGAACCTCTTATTT pLKO.1 1887 CDS 100% 15.000 21.000 N Nlrp3 n/a
2 TRCN0000101066 CCGGCCTTACTTCAATCTGTT pLKO.1 2810 CDS 100% 4.950 3.960 N Nlrp3 n/a
3 TRCN0000101065 CCATACCTTCAGTCTTGTCTT pLKO.1 3652 3UTR 100% 4.950 3.465 N Nlrp3 n/a
4 TRCN0000101068 CCCGGACTGTAAACTACAGAT pLKO.1 2943 CDS 100% 4.950 3.465 N Nlrp3 n/a
5 TRCN0000101069 CCACATGACTTTCCAGGAGTT pLKO.1 1689 CDS 100% 4.050 2.835 N Nlrp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.