Transcript: Mouse XM_006532899.3

PREDICTED: Mus musculus WD repeat containing, antisense to Trp53 (Wrap53), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wrap53 (216853)
Length:
2209
CDS:
1313..2125

Additional Resources:

NCBI RefSeq record:
XM_006532899.3
NBCI Gene record:
Wrap53 (216853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217565 GATAATGTCCTTCGGATTTAC pLKO.1 1832 CDS 100% 13.200 18.480 N Wrap53 n/a
2 TRCN0000328526 TGATAATGTCCTTCGGATTTA pLKO_005 1831 CDS 100% 13.200 18.480 N Wrap53 n/a
3 TRCN0000216152 CTATGATTACTGCTGGTATTC pLKO.1 1942 CDS 100% 10.800 15.120 N Wrap53 n/a
4 TRCN0000298500 CTATGATTACTGCTGGTATTC pLKO_005 1942 CDS 100% 10.800 15.120 N WRAP53 n/a
5 TRCN0000197461 CCAGAATTGTACAGTGAACAA pLKO.1 1862 CDS 100% 4.950 3.465 N Wrap53 n/a
6 TRCN0000198445 GAGGAGCAAGATGTTTCTGAA pLKO.1 1571 CDS 100% 4.950 3.465 N Wrap53 n/a
7 TRCN0000328585 GAGGAGCAAGATGTTTCTGAA pLKO_005 1571 CDS 100% 4.950 3.465 N Wrap53 n/a
8 TRCN0000198352 GATTCACATCTGGGATGCATT pLKO.1 2023 CDS 100% 4.950 3.465 N Wrap53 n/a
9 TRCN0000198458 GTTTCTGAACATGCGAGTCTT pLKO.1 1583 CDS 100% 4.950 3.465 N Wrap53 n/a
10 TRCN0000328525 GTTTCTGAACATGCGAGTCTT pLKO_005 1583 CDS 100% 4.950 3.465 N Wrap53 n/a
11 TRCN0000328587 GTACCTCTGGAAGTAGAATTT pLKO_005 1520 CDS 100% 0.000 0.000 N Wrap53 n/a
12 TRCN0000176823 GAACTTCTTGAAAGGTTGCAA pLKO.1 1771 CDS 100% 3.000 1.800 N Wrap53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.