Transcript: Mouse XM_006532903.3

PREDICTED: Mus musculus neuroligin 2 (Nlgn2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlgn2 (216856)
Length:
5277
CDS:
1038..3197

Additional Resources:

NCBI RefSeq record:
XM_006532903.3
NBCI Gene record:
Nlgn2 (216856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328640 CGCAGTAGTCATGACCTATTG pLKO_005 2279 CDS 100% 10.800 8.640 N Nlgn2 n/a
2 TRCN0000328639 CTGAACGCATCACTATCTTTG pLKO_005 1453 CDS 100% 10.800 8.640 N Nlgn2 n/a
3 TRCN0000196058 GCGCAGTAGTCATGACCTATT pLKO.1 2278 CDS 100% 10.800 8.640 N Nlgn2 n/a
4 TRCN0000075281 CCTCAACTACGACATGCTCAT pLKO.1 1805 CDS 100% 4.050 3.240 N NLGN2 n/a
5 TRCN0000184441 GCAGTATCTGCACATAGGCTT pLKO.1 2420 CDS 100% 2.640 2.112 N Nlgn2 n/a
6 TRCN0000328638 GCAGTATCTGCACATAGGCTT pLKO_005 2420 CDS 100% 2.640 2.112 N Nlgn2 n/a
7 TRCN0000328714 TTTGCCTCCTCCAAGAATTTC pLKO_005 3648 3UTR 100% 13.200 9.240 N Nlgn2 n/a
8 TRCN0000180497 GCAAGTTCAACAGCAAGGAAA pLKO.1 2398 CDS 100% 4.950 3.465 N Nlgn2 n/a
9 TRCN0000328637 GCAAGTTCAACAGCAAGGAAA pLKO_005 2398 CDS 100% 4.950 3.465 N Nlgn2 n/a
10 TRCN0000184124 CTGATATTGACCTAGGCCCAA pLKO.1 2647 CDS 100% 2.160 1.512 N Nlgn2 n/a
11 TRCN0000184175 GCCCATGTGAAGACATGCTTT pLKO.1 3475 3UTR 100% 0.495 0.347 N Nlgn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.