Transcript: Mouse XM_006533323.3

PREDICTED: Mus musculus FAT atypical cadherin 2 (Fat2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fat2 (245827)
Length:
18300
CDS:
3888..16943

Additional Resources:

NCBI RefSeq record:
XM_006533323.3
NBCI Gene record:
Fat2 (245827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095003 CCTCGTTATGAGGCAAATGTT pLKO.1 8559 CDS 100% 5.625 7.875 N Fat2 n/a
2 TRCN0000095000 GCCGAGTTCTATTACGCCTTT pLKO.1 4428 CDS 100% 4.050 5.670 N Fat2 n/a
3 TRCN0000246139 ATTTGAGGCTGATCCATATAA pLKO_005 12281 CDS 100% 15.000 10.500 N FAT2 n/a
4 TRCN0000095002 CCAATGAAACAGCCTCTATTT pLKO.1 15328 CDS 100% 13.200 9.240 N Fat2 n/a
5 TRCN0000095001 CCCTATACAATGCCACCATTT pLKO.1 3994 CDS 100% 10.800 7.560 N Fat2 n/a
6 TRCN0000094999 GCCAAGAACAAGAAGGATGTA pLKO.1 17711 3UTR 100% 4.950 3.465 N Fat2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2404 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.