Transcript: Mouse XM_006533548.2

PREDICTED: Mus musculus phosphoinositide-3-kinase, regulatory subunit 5, p101 (Pik3r5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pik3r5 (320207)
Length:
4279
CDS:
65..2680

Additional Resources:

NCBI RefSeq record:
XM_006533548.2
NBCI Gene record:
Pik3r5 (320207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088608 CGTCCCTCTAACACTACAGAT pLKO.1 2215 CDS 100% 4.950 6.930 N Pik3r5 n/a
2 TRCN0000088612 GTCCCTCTAACACTACAGATT pLKO.1 2216 CDS 100% 4.950 3.960 N Pik3r5 n/a
3 TRCN0000195068 CCTCTAACACTACAGATTATT pLKO.1 2219 CDS 100% 15.000 10.500 N PIK3R5 n/a
4 TRCN0000362372 CCTCTAACACTACAGATTATT pLKO_005 2219 CDS 100% 15.000 10.500 N Pik3r5 n/a
5 TRCN0000362385 AGGTTCTATAAACTCTTAAAG pLKO_005 1310 CDS 100% 13.200 9.240 N Pik3r5 n/a
6 TRCN0000362374 TGAAGAGGCAGAACCCTAAAT pLKO_005 2385 CDS 100% 13.200 9.240 N Pik3r5 n/a
7 TRCN0000362298 TCTTTGGCTCTGATCGGATTT pLKO_005 1605 CDS 100% 10.800 7.560 N Pik3r5 n/a
8 TRCN0000088610 CCAGATCAGTACATCCTACAT pLKO.1 2422 CDS 100% 4.950 3.465 N Pik3r5 n/a
9 TRCN0000088611 GCAAACTTCAGTCCAAGACAA pLKO.1 711 CDS 100% 4.950 3.465 N Pik3r5 n/a
10 TRCN0000088609 GCAGAAGTTCAACAGGTTCTA pLKO.1 1297 CDS 100% 4.950 3.465 N Pik3r5 n/a
11 TRCN0000033270 CTCACCTTCATTGATGCTGAA pLKO.1 443 CDS 100% 4.050 2.835 N PIK3R5 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3216 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.