Transcript: Mouse XM_006533601.4

PREDICTED: Mus musculus myosin XVIIIA (Myo18a), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Myo18a (360013)
Length:
7576
CDS:
222..6431

Additional Resources:

NCBI RefSeq record:
XM_006533601.4
NBCI Gene record:
Myo18a (360013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533601.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417584 GATCGACTGGTGGAGATTAAT pLKO_005 1041 CDS 100% 15.000 21.000 N MYO18A n/a
2 TRCN0000090338 CGTTAGAGTATTAAGTGCAAT pLKO.1 7118 3UTR 100% 4.950 6.930 N Myo18a n/a
3 TRCN0000323896 CGTTAGAGTATTAAGTGCAAT pLKO_005 7118 3UTR 100% 4.950 6.930 N Myo18a n/a
4 TRCN0000090341 GCGGGACTTTGAATCAGAGAA pLKO.1 5201 CDS 100% 4.950 6.930 N Myo18a n/a
5 TRCN0000323895 GCGGGACTTTGAATCAGAGAA pLKO_005 5201 CDS 100% 4.950 6.930 N Myo18a n/a
6 TRCN0000305805 AGTCGCTGTGCATACAGATTA pLKO_005 3322 CDS 100% 13.200 9.240 N Myo18a n/a
7 TRCN0000305806 GATCATGCTGGACCACTTAAA pLKO_005 5273 CDS 100% 13.200 9.240 N Myo18a n/a
8 TRCN0000090342 CCATCGGATGATGAGCATGAT pLKO.1 6321 CDS 100% 4.950 3.465 N Myo18a n/a
9 TRCN0000090339 GCTGAATTACACCAAGCAGAA pLKO.1 3101 CDS 100% 4.050 2.835 N Myo18a n/a
10 TRCN0000323828 GCTGAATTACACCAAGCAGAA pLKO_005 3101 CDS 100% 4.050 2.835 N Myo18a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533601.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.