Transcript: Mouse XM_006533662.3

PREDICTED: Mus musculus dynein, axonemal, intermediate chain 2 (Dnaic2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnaic2 (432611)
Length:
4196
CDS:
1707..3578

Additional Resources:

NCBI RefSeq record:
XM_006533662.3
NBCI Gene record:
Dnaic2 (432611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254794 CATCGACATCTACGAGGAATA pLKO_005 2084 CDS 100% 10.800 15.120 N Dnaic2 n/a
2 TRCN0000347450 GCCCATCGAAGTTGTCATTAT pLKO_005 2603 CDS 100% 13.200 9.240 N Dnaic2 n/a
3 TRCN0000347373 GGTTATCCAATGAGTAGTTAC pLKO_005 3888 3UTR 100% 10.800 7.560 N Dnaic2 n/a
4 TRCN0000116368 GCACTGCATCAAGCAGAACAA pLKO.1 2060 CDS 100% 4.950 3.465 N DNAI2 n/a
5 TRCN0000254795 ATGGAGAGCTGTGGCGTTAAT pLKO_005 1911 CDS 100% 13.200 7.920 N Dnaic2 n/a
6 TRCN0000116370 CACTGCATCAAGCAGAACAAT pLKO.1 2061 CDS 100% 5.625 3.938 N DNAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.