Transcript: Mouse XM_006533731.2

PREDICTED: Mus musculus golgi SNAP receptor complex member 1 (Gosr1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gosr1 (53334)
Length:
1236
CDS:
73..819

Additional Resources:

NCBI RefSeq record:
XM_006533731.2
NBCI Gene record:
Gosr1 (53334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533731.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100758 CAGGATTATACACACGAATTT pLKO.1 412 CDS 100% 13.200 18.480 N Gosr1 n/a
2 TRCN0000323678 CAGGATTATACACACGAATTT pLKO_005 412 CDS 100% 13.200 18.480 N Gosr1 n/a
3 TRCN0000305541 CGTGAACAGCCTGATACAAAG pLKO_005 708 CDS 100% 10.800 15.120 N Gosr1 n/a
4 TRCN0000100756 GCAGGATTATACACACGAATT pLKO.1 411 CDS 100% 0.000 0.000 N Gosr1 n/a
5 TRCN0000305542 CTGACACAACACCGCTATTAA pLKO_005 221 CDS 100% 15.000 10.500 N Gosr1 n/a
6 TRCN0000380945 AGAGGAATGCTCAAGTCAATT pLKO_005 649 CDS 100% 13.200 9.240 N Gosr1 n/a
7 TRCN0000379732 GGAAAGATATTGAGTCATATA pLKO_005 494 CDS 100% 13.200 9.240 N Gosr1 n/a
8 TRCN0000381471 GGATCAAGCCAAGACAGAATG pLKO_005 244 CDS 100% 10.800 7.560 N GOSR1 n/a
9 TRCN0000100757 CGAAACTCTGATCGTCTGATA pLKO.1 577 CDS 100% 4.950 3.465 N Gosr1 n/a
10 TRCN0000323615 CGAAACTCTGATCGTCTGATA pLKO_005 577 CDS 100% 4.950 3.465 N Gosr1 n/a
11 TRCN0000100755 GCCACGAGATTGGATGTGAAT pLKO.1 1189 3UTR 100% 4.950 3.465 N Gosr1 n/a
12 TRCN0000323616 GCCACGAGATTGGATGTGAAT pLKO_005 1189 3UTR 100% 4.950 3.465 N Gosr1 n/a
13 TRCN0000100759 GCTCAAGTCAATTCACAGCAA pLKO.1 657 CDS 100% 2.640 1.848 N Gosr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533731.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.