Transcript: Mouse XM_006533754.3

PREDICTED: Mus musculus Rho GTPase activating protein 27 (Arhgap27), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap27 (544817)
Length:
3492
CDS:
72..2126

Additional Resources:

NCBI RefSeq record:
XM_006533754.3
NBCI Gene record:
Arhgap27 (544817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254980 CCGGCACAAGCTCCGTAAATT pLKO_005 1457 CDS 100% 15.000 21.000 N Arhgap27 n/a
2 TRCN0000254979 GGTTTCATGCAGTCCATATTT pLKO_005 3251 3UTR 100% 15.000 21.000 N Arhgap27 n/a
3 TRCN0000267530 CAGCACGGGAAGCCATATTTC pLKO_005 792 CDS 100% 13.200 9.240 N Arhgap27 n/a
4 TRCN0000267528 CTGGCTGGTCCTGTCAAATTA pLKO_005 706 CDS 100% 15.000 9.000 N Arhgap27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466675 GTACCCCAGTCATAGTGCGCCCTT pLX_317 22.4% 63.4% 64.9% V5 (many diffs) n/a
Download CSV