Transcript: Mouse XM_006533850.1

PREDICTED: Mus musculus gasdermin A (Gsdma), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gsdma (57911)
Length:
1738
CDS:
108..1499

Additional Resources:

NCBI RefSeq record:
XM_006533850.1
NBCI Gene record:
Gsdma (57911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193334 CCAACAGAAGCTTCTAGTAAA pLKO.1 1196 CDS 100% 13.200 18.480 N Gsdma n/a
2 TRCN0000249077 CCAACAGAAGCTTCTAGTAAA pLKO_005 1196 CDS 100% 13.200 18.480 N Gsdma n/a
3 TRCN0000249073 ACTGATGGTCAACGGCAAAGA pLKO_005 737 CDS 100% 4.950 6.930 N Gsdma n/a
4 TRCN0000249075 CAGGAGAAGGGAAGTTCATAT pLKO_005 871 CDS 100% 13.200 9.240 N Gsdma n/a
5 TRCN0000249076 GCATTCCACACATTTGCAATG pLKO_005 766 CDS 100% 6.000 4.200 N Gsdma n/a
6 TRCN0000175915 GACAGTGGCAACTTTAGCTTT pLKO.1 330 CDS 100% 4.950 2.475 Y Gsdma n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09953 pDONR223 100% 82.4% 85% None (many diffs) n/a
2 ccsbBroad304_09953 pLX_304 0% 82.4% 85% V5 (many diffs) n/a
Download CSV