Transcript: Mouse XM_006534142.3

PREDICTED: Mus musculus major facilitator superfamily domain containing 11 (Mfsd11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mfsd11 (69900)
Length:
2647
CDS:
363..1712

Additional Resources:

NCBI RefSeq record:
XM_006534142.3
NBCI Gene record:
Mfsd11 (69900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123658 GAGCTTAAATAGCACAGATTT pLKO.1 473 CDS 100% 13.200 10.560 N Mfsd11 n/a
2 TRCN0000123657 CGGAAACCAGATCCTGAGAAT pLKO.1 933 CDS 100% 4.950 3.960 N Mfsd11 n/a
3 TRCN0000123655 GCATCTGTCTTCATCGGAATT pLKO.1 672 CDS 100% 0.000 0.000 N Mfsd11 n/a
4 TRCN0000123656 GCCTCATTGGACTTTCTGGAA pLKO.1 1189 CDS 100% 2.640 1.848 N Mfsd11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534142.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04059 pDONR223 100% 87.5% 93% None (many diffs) n/a
Download CSV