Transcript: Mouse XM_006534189.2

PREDICTED: Mus musculus unc-13 homolog D (C. elegans) (Unc13d), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc13d (70450)
Length:
4208
CDS:
352..3609

Additional Resources:

NCBI RefSeq record:
XM_006534189.2
NBCI Gene record:
Unc13d (70450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027733 CCAGAAACTCATTGGCGTCAA pLKO.1 2673 CDS 100% 4.050 5.670 N Unc13d n/a
2 TRCN0000379660 GGTCTACTGTAGCCTTATAAA pLKO_005 2361 CDS 100% 15.000 12.000 N Unc13d n/a
3 TRCN0000027718 GCTTTGCTACATGAACACCAA pLKO.1 2751 CDS 100% 2.640 2.112 N Unc13d n/a
4 TRCN0000136261 GCTTTGCTACATGAACACCAA pLKO.1 2751 CDS 100% 2.640 2.112 N UNC13D n/a
5 TRCN0000027704 CTACCTGCTTTGCCCAAATTA pLKO.1 2249 CDS 100% 15.000 10.500 N Unc13d n/a
6 TRCN0000381377 GTCGCACATGGAACAAGATTT pLKO_005 1865 CDS 100% 13.200 9.240 N Unc13d n/a
7 TRCN0000027692 CCTGGTCTACTGTAGCCTTAT pLKO.1 2358 CDS 100% 10.800 7.560 N Unc13d n/a
8 TRCN0000027723 CGAGACCTTTATCTTGGAGTT pLKO.1 903 CDS 100% 4.050 2.835 N Unc13d n/a
9 TRCN0000381086 TGCTGTGTGTGGTGGTAAATA pLKO_005 2438 CDS 100% 15.000 9.000 N Unc13d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.