Transcript: Mouse XM_006534324.3

PREDICTED: Mus musculus 5-phosphohydroxy-L-lysine phospholyase (Phykpl), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phykpl (72947)
Length:
2084
CDS:
282..1727

Additional Resources:

NCBI RefSeq record:
XM_006534324.3
NBCI Gene record:
Phykpl (72947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120406 GCAACTGAAGAGGCGGAATAT pLKO.1 1422 CDS 100% 13.200 18.480 N Phykpl n/a
2 TRCN0000336326 GCAACTGAAGAGGCGGAATAT pLKO_005 1422 CDS 100% 13.200 18.480 N Phykpl n/a
3 TRCN0000120405 GTGGTATTAGACCATGCTTAT pLKO.1 681 CDS 100% 10.800 15.120 N Phykpl n/a
4 TRCN0000120403 GCATGACAACATCGTGGACTA pLKO.1 536 CDS 100% 4.050 3.240 N Phykpl n/a
5 TRCN0000336265 GCATGACAACATCGTGGACTA pLKO_005 536 CDS 100% 4.050 3.240 N Phykpl n/a
6 TRCN0000120404 GCAGTCCTAGATGTCTTGAAA pLKO.1 1245 CDS 100% 5.625 3.938 N Phykpl n/a
7 TRCN0000336325 GCAGTCCTAGATGTCTTGAAA pLKO_005 1245 CDS 100% 5.625 3.938 N Phykpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534324.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04466 pDONR223 100% 80.4% 81.2% None (many diffs) n/a
2 ccsbBroad304_04466 pLX_304 0% 80.4% 81.2% V5 (many diffs) n/a
Download CSV