Transcript: Mouse XM_006534356.2

PREDICTED: Mus musculus ring finger protein 145 (Rnf145), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf145 (74315)
Length:
3464
CDS:
238..2229

Additional Resources:

NCBI RefSeq record:
XM_006534356.2
NBCI Gene record:
Rnf145 (74315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226314 TATGCATTACGTAGGTTATAT pLKO_005 408 CDS 100% 15.000 21.000 N Rnf145 n/a
2 TRCN0000226317 CCCTGATTTGCGAGGGATAAT pLKO_005 2509 3UTR 100% 13.200 18.480 N Rnf145 n/a
3 TRCN0000193419 CCTATGAAGGACCAATGTATT pLKO.1 560 CDS 100% 13.200 18.480 N Rnf145 n/a
4 TRCN0000226316 CTCGTGTTCCCTGCGTATATG pLKO_005 1405 CDS 100% 13.200 18.480 N Rnf145 n/a
5 TRCN0000176298 CTAATCTCCTAGTACCGTATA pLKO.1 803 CDS 100% 10.800 15.120 N Rnf145 n/a
6 TRCN0000226315 TAATCTCCTAGTACCGTATAA pLKO_005 804 CDS 100% 13.200 10.560 N Rnf145 n/a
7 TRCN0000218874 GGACGCTGTGAATAAGATTAA pLKO_005 1776 CDS 100% 13.200 9.240 N Rnf145 n/a
8 TRCN0000174538 CGCAATGAAATCAAAGATGTA pLKO.1 2730 3UTR 100% 4.950 3.465 N Rnf145 n/a
9 TRCN0000175069 GCTGTGAATAAGATTAAGTCT pLKO.1 1780 CDS 100% 3.000 2.100 N Rnf145 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09703 pDONR223 100% 85.7% 93.6% None (many diffs) n/a
2 ccsbBroad304_09703 pLX_304 0% 85.7% 93.6% V5 (many diffs) n/a
Download CSV