Transcript: Mouse XM_006534562.3

PREDICTED: Mus musculus glucagon-like peptide 2 receptor (Glp2r), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glp2r (93896)
Length:
2091
CDS:
41..1462

Additional Resources:

NCBI RefSeq record:
XM_006534562.3
NBCI Gene record:
Glp2r (93896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240019 TACTTACCTTGGTGGAATAAA pLKO_005 281 CDS 100% 15.000 21.000 N LOC633778 n/a
2 TRCN0000240021 TGCTTTGTGTAACAGTTAATT pLKO_005 969 CDS 100% 15.000 10.500 N LOC633778 n/a
3 TRCN0000240022 ACTGCACTGCACACGCAATTA pLKO_005 541 CDS 100% 13.200 9.240 N LOC633778 n/a
4 TRCN0000221839 CGAGAAACCTTCTGGTGTATT pLKO.1 184 CDS 100% 13.200 9.240 N Glp2r n/a
5 TRCN0000240020 AGGTCCTCCTGCACTACTTTG pLKO_005 717 CDS 100% 10.800 7.560 N LOC633778 n/a
6 TRCN0000221841 CCTGTCCTTCATACTTACCTT pLKO.1 270 CDS 100% 3.000 2.100 N Glp2r n/a
7 TRCN0000221838 GCTGTTTGTTATTCCCTGGAT pLKO.1 862 CDS 100% 2.640 1.848 N Glp2r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.